pVER-LacI
(Plasmid
#164830)
-
PurposeLacI protein regulates expression of yellow fluorescent protein. For measuring dose-response curves.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 164830 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAN1818
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)MG1655
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameLacI
-
Alt namelac repressor
-
SpeciesE. coli
-
Insert Size (bp)1083
- Promoter Ptac
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AscI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer CTCTCGGCATGGACGAGCTGT
- 3′ sequencing primer TGCAGCGAGTCAGTGAGCGAGGAAGCACCTC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byderivative of pAN1818 plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Derived from the pAN1818 plasmid from the Chris Voigt lab.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pVER-LacI was a gift from Drew Tack (Addgene plasmid # 164830 ; http://n2t.net/addgene:164830 ; RRID:Addgene_164830) -
For your References section:
The genotype-phenotype landscape of an allosteric protein. Tack DS, Tonner PD, Pressman A, Olson ND, Levy SF, Romantseva EF, Alperovich N, Vasilyeva O, Ross D. Mol Syst Biol. 2021 Mar;17(3):e10179. doi: 10.15252/msb.202010179. 10.15252/msb.202010179 PubMed 33784029