LentiCRISPRv2 NT sgRNA3
(Plasmid
#164929)
-
PurposeExpresses Non-targeting sgRNA3 control in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 164929 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneLentiCRISPRv2
- Backbone size w/o insert (bp) 12993
- Total vector size (bp) 13013
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNon-targeting sgRNA3 (verified for knockout)
-
Alt namesgRNA3
-
SpeciesH. sapiens (human)
-
Insert Size (bp)20
- Promoter EFS promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (not destroyed)
- 3′ cloning site BsmBI (not destroyed)
- 5′ sequencing primer aatggactatcatatgcttaccg
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LentiCRISPRv2 NT sgRNA3 was a gift from Ji Luo (Addgene plasmid # 164929 ; http://n2t.net/addgene:164929 ; RRID:Addgene_164929) -
For your References section:
CRISPR/Cas9-mediated gene knockout is insensitive to target copy number but is dependent on guide RNA potency and Cas9/sgRNA threshold expression level. Yuen G, Khan FJ, Gao S, Stommel JM, Batchelor E, Wu X, Luo J. Nucleic Acids Res. 2017 Nov 16;45(20):12039-12053. doi: 10.1093/nar/gkx843. 10.1093/nar/gkx843 PubMed 29036671