pLVX-NPC1(F503/4A)-FLAG
(Plasmid
#164974)
-
PurposeLentiviral vector for NPC1 expression in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 164974 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLVX-AcGFP-N1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 9519
- Total vector size (bp) 13380
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNPC1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3867
-
MutationF503A and F504A
-
GenBank ID
-
Entrez GeneNPC1 (a.k.a. NPC, POGZ, SLC65A1)
- Promoter EF1a
-
Tag
/ Fusion Protein
- FLAG (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site XmaI (not destroyed)
- 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
- 3′ sequencing primer CATGCTCCAGACTGCCTTG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLVX-NPC1(F503/4A)-FLAG was a gift from Roberto Zoncu (Addgene plasmid # 164974 ; http://n2t.net/addgene:164974 ; RRID:Addgene_164974) -
For your References section:
NPC1-mTORC1 Signaling Couples Cholesterol Sensing to Organelle Homeostasis and Is a Targetable Pathway in Niemann-Pick Type C. Davis OB, Shin HR, Lim CY, Wu EY, Kukurugya M, Maher CF, Perera RM, Ordonez MP, Zoncu R. Dev Cell. 2020 Dec 7. pii: S1534-5807(20)30925-4. doi: 10.1016/j.devcel.2020.11.016. 10.1016/j.devcel.2020.11.016 PubMed 33308480