pCAG-TWIN-STREP-FLAG-FLCN
(Plasmid
#164981)
-
PurposeFLCN expressing vector for mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 164981 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCAG TWIN STREP FLAG
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFLCN
-
Alt nameFolliculin
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1740
-
Entrez GeneFLCN (a.k.a. BHD, DENND8B, FLCL)
- Promoter CAG
-
Tag
/ Fusion Protein
- 2xSTREP FLAG (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer pCAG-F: CTTCTTCTTTTTCCTACAGCTCCTGGGC
- 3′ sequencing primer pCAG-R: CAGTGGTATTTGTGAGCCAGGGCATT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG-TWIN-STREP-FLAG-FLCN was a gift from Roberto Zoncu (Addgene plasmid # 164981 ; http://n2t.net/addgene:164981 ; RRID:Addgene_164981) -
For your References section:
Structural mechanism of a Rag GTPase activation checkpoint by the lysosomal folliculin complex. Lawrence RE, Fromm SA, Fu Y, Yokom AL, Kim DJ, Thelen AM, Young LN, Lim CY, Samelson AJ, Hurley JH, Zoncu R. Science. 2019 Nov 22;366(6468):971-977. doi: 10.1126/science.aax0364. Epub 2019 Oct 31. 10.1126/science.aax0364 PubMed 31672913