CRISPR_HLA_DPA
(Plasmid
#164988)
-
PurposeExpression of gRNA targeting HLA-DPA locus, including DPA1*02:01:08
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 164988 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepXPR_001 (lentiCRISPRv1, Addgene #49535)
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namegRNA against HLA-DPA1*02:01:08
-
gRNA/shRNA sequenceCGTCACATGGCTGTGCAATG
-
SpeciesH. sapiens (human)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (unknown if destroyed)
- 3′ cloning site BsmBI (unknown if destroyed)
- 5′ sequencing primer U6-F (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CRISPR_HLA_DPA was a gift from Matthew Meyerson (Addgene plasmid # 164988 ; http://n2t.net/addgene:164988 ; RRID:Addgene_164988) -
For your References section:
Antigen identification for HLA class I- and HLA class II-restricted T cell receptors using cytokine-capturing antigen-presenting cells. Lee MN, Meyerson M. Sci Immunol. 2021 Jan 22;6(55). pii: 6/55/eabf4001. doi: 10.1126/sciimmunol.abf4001. 10.1126/sciimmunol.abf4001 PubMed 33483338