Skip to main content

CRISPR_HLA_DPA
(Plasmid #164988)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 164988 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pXPR_001 (lentiCRISPRv1, Addgene #49535)
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    gRNA against HLA-DPA1*02:01:08
  • gRNA/shRNA sequence
    CGTCACATGGCTGTGCAATG
  • Species
    H. sapiens (human)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (unknown if destroyed)
  • 3′ cloning site BsmBI (unknown if destroyed)
  • 5′ sequencing primer U6-F
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CRISPR_HLA_DPA was a gift from Matthew Meyerson (Addgene plasmid # 164988 ; http://n2t.net/addgene:164988 ; RRID:Addgene_164988)
  • For your References section:

    Antigen identification for HLA class I- and HLA class II-restricted T cell receptors using cytokine-capturing antigen-presenting cells. Lee MN, Meyerson M. Sci Immunol. 2021 Jan 22;6(55). pii: 6/55/eabf4001. doi: 10.1126/sciimmunol.abf4001. 10.1126/sciimmunol.abf4001 PubMed 33483338