Skip to main content

pSB3K3-CT61
(Plasmid #165403)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 165403 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSB3K3
  • Backbone size w/o insert (bp) 2750
  • Total vector size (bp) 8988
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    CT61 gene circuit
  • Species
    Synthetic; E. coli
  • Insert Size (bp)
    6238

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site PstI (not destroyed)
  • 5′ sequencing primer tgccacctgacgtctaagaa
  • 3′ sequencing primer attaccgcctttgagtgagc
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that the GFP (D117G) and LuxR (S116A, V135I, M174I) sequence variants do not affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSB3K3-CT61 was a gift from Xiaojun Tian (Addgene plasmid # 165403 ; http://n2t.net/addgene:165403 ; RRID:Addgene_165403)
  • For your References section:

    Winner-takes-all resource competition redirects cascading cell fate transitions. Zhang R, Goetz H, Melendez-Alvarez J, Li J, Ding T, Wang X, Tian XJ. Nat Commun. 2021 Feb 8;12(1):853. doi: 10.1038/s41467-021-21125-3. 10.1038/s41467-021-21125-3 PubMed 33558556