px330 p300 gRNA
(Plasmid
#165591)
-
PurposeInsertion of p300 degron
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 165591 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepx330
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameP300
-
gRNA/shRNA sequenceCCATTGGGGATCAGCTCATC
-
SpeciesM. musculus (mouse)
-
MutationNA
-
Entrez GeneSmarca2 (a.k.a. 2610209L14Rik, SNF2alpha, Snf, Snf2l2, br, brahma, brm)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
px330 p300 gRNA was a gift from Cornelis Murre (Addgene plasmid # 165591 ; http://n2t.net/addgene:165591 ; RRID:Addgene_165591) -
For your References section:
Calcium signaling instructs NIPBL recruitment at active enhancers and promoters via distinct mechanisms to reconstruct genome compartmentalization. Zhu Y, Denholtz M, Lu H, Murre C. Genes Dev. 2021 Jan 1;35(1-2):65-81. doi: 10.1101/gad.343475.120. Epub 2020 Dec 17. 10.1101/gad.343475.120 PubMed 33334824