Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

px330 p300 gRNA
(Plasmid #165591)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 165591 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    P300
  • gRNA/shRNA sequence
    CCATTGGGGATCAGCTCATC
  • Species
    M. musculus (mouse)
  • Mutation
    NA
  • Entrez Gene
    Smarca2 (a.k.a. 2610209L14Rik, SNF2alpha, Snf, Snf2l2, br, brahma, brm)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    px330 p300 gRNA was a gift from Cornelis Murre (Addgene plasmid # 165591 ; http://n2t.net/addgene:165591 ; RRID:Addgene_165591)
  • For your References section:

    Calcium signaling instructs NIPBL recruitment at active enhancers and promoters via distinct mechanisms to reconstruct genome compartmentalization. Zhu Y, Denholtz M, Lu H, Murre C. Genes Dev. 2021 Jan 1;35(1-2):65-81. doi: 10.1101/gad.343475.120. Epub 2020 Dec 17. 10.1101/gad.343475.120 PubMed 33334824