Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pGG198
(Plasmid #165605)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 165605 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pGG184
  • Backbone manufacturer
    Marcus Noyes Lab (Addgene #165604)
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    hEGFP protospacer ('CGGCG' PAM) downstream of the HIS3/GFP promoter
  • Mutation
    Secondary protospacer ('CGGCG' PAM) inserted downstream of the HIS3/GFP promoter
  • Promoter lac

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer GAAATATGTATCCGCTCATGAC
  • 3′ sequencing primer GTGACCATTAACATCACCATC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGG198 was a gift from Marcus Noyes (Addgene plasmid # 165605 ; http://n2t.net/addgene:165605 ; RRID:Addgene_165605)
  • For your References section:

    Engineered dual selection for directed evolution of SpCas9 PAM specificity. Goldberg GW, Spencer JM, Giganti DO, Camellato BR, Agmon N, Ichikawa DM, Boeke JD, Noyes MB. Nat Commun. 2021 Jan 13;12(1):349. doi: 10.1038/s41467-020-20650-x. 10.1038/s41467-020-20650-x PubMed 33441553