- 
            Purpose(Empty Backbone) Bacterial expression of dCas9 (aTc control) and sgRNA (arabinose control)
- 
              Depositing Lab
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 166005 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepCas9-CR4
- Backbone size (bp) 1700
- 
              Vector typeBacterial Expression, CRISPR
Growth in Bacteria
- 
            Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)DH5alpha
- 
            Copy numberLow Copy
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGTCACACTTTGCTATGCCA (Common Sequencing Primers)
Resource Information
- 
            
            
            Supplemental Documents
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Tight inducible control of dCas9 and sgRNA expression in bacteria. sgRNA spacer is cloned in between BsaI sites, replacing an RFP cassette to facilitate identification of successful clones.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: pdCas9-sgRNA-RFP was a gift from Martin Buck (Addgene plasmid # 166005 ; http://n2t.net/addgene:166005 ; RRID:Addgene_166005)
- 
                For your References section: An easy-to-use CRISPRi plasmid tool for inducible knockdown in E. coli. Bradley RW. Biotechnol Rep (Amst). 2021 Oct 9;32:e00680. doi: 10.1016/j.btre.2021.e00680. eCollection 2021 Dec. 10.1016/j.btre.2021.e00680 PubMed 34703773
