pEN-CAG-mRFP-PCNA pc2729
(Plasmid
#166040)
-
PurposeExpresses mRFP tagged human PCNA in mammalian cells.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 166040 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCAG
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameProliferating Cell Nuclear Antigen
-
SpeciesH. sapiens (human)
-
Insert Size (bp)737
-
GenBank IDNM_002592.2
-
Entrez GenePCNA (a.k.a. ATLD2)
- Promoter CAG
-
Tag
/ Fusion Protein
- mRFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site AflIII (not destroyed)
- 5′ sequencing primer AGCTGGACATCACCTCCCACAACG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEN-CAG-mRFP-PCNA pc2729 was a gift from Cristina Cardoso (Addgene plasmid # 166040 ; http://n2t.net/addgene:166040 ; RRID:Addgene_166040) -
For your References section:
Peripheral re-localization of constitutive heterochromatin advances its replication timing and impairs maintenance of silencing marks. Heinz KS, Casas-Delucchi CS, Torok T, Cmarko D, Rapp A, Raska I, Cardoso MC. Nucleic Acids Res. 2018 Jul 6;46(12):6112-6128. doi: 10.1093/nar/gky368. 10.1093/nar/gky368 PubMed 29750270