Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pEN-CAG-mRFP-PCNA pc2729
(Plasmid #166040)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 166040 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCAG
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Proliferating Cell Nuclear Antigen
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    737
  • GenBank ID
    NM_002592.2
  • Entrez Gene
    PCNA (a.k.a. ATLD2)
  • Promoter CAG
  • Tag / Fusion Protein
    • mRFP (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site AflIII (not destroyed)
  • 5′ sequencing primer AGCTGGACATCACCTCCCACAACG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEN-CAG-mRFP-PCNA pc2729 was a gift from Cristina Cardoso (Addgene plasmid # 166040 ; http://n2t.net/addgene:166040 ; RRID:Addgene_166040)
  • For your References section:

    Peripheral re-localization of constitutive heterochromatin advances its replication timing and impairs maintenance of silencing marks. Heinz KS, Casas-Delucchi CS, Torok T, Cmarko D, Rapp A, Raska I, Cardoso MC. Nucleic Acids Res. 2018 Jul 6;46(12):6112-6128. doi: 10.1093/nar/gky368. 10.1093/nar/gky368 PubMed 29750270