PaCasp7a
(Plasmid
#166051)
-
Purposea caspase of Porites astreoides, which has higher sequence similarity with human caspase-7 but has a CARD domain and function as an initiator caspase
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 166051 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepET11a
- Backbone size w/o insert (bp) 5677
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePorites astreiodes caspase-7a
-
Alt namePaCasp7a
-
SpeciesPorites astreoides
-
Insert Size (bp)1206
- Promoter T7 promoter
-
Tag
/ Fusion Protein
- His tag (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer GAAGGAGATATACATATGCAGG
- 3′ sequencing primer CACTGAGGATCCGGCTGCTAAC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bysynthesized by gescript
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PaCasp7a was a gift from Clay Clark (Addgene plasmid # 166051 ; http://n2t.net/addgene:166051 ; RRID:Addgene_166051) -
For your References section:
Caspases from scleractinian coral show unique regulatory features. Shrestha S, Tung J, Grinshpon RD, Swartz P, Hamilton PT, Dimos B, Mydlarz L, Clark AC. J Biol Chem. 2020 Oct 23;295(43):14578-14591. doi: 10.1074/jbc.RA120.014345. Epub 2020 Aug 11. 10.1074/jbc.RA120.014345 PubMed 32788218