Skip to main content

OfCasp3a
(Plasmid #166053)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 166053 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET11a
  • Backbone size w/o insert (bp) 5677
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Orbicella faveolata caspase-3a
  • Alt name
    OfCasp3a
  • Species
    Orbicella faveolata
  • Insert Size (bp)
    1209
  • Promoter T7 lac promoter
  • Tag / Fusion Protein
    • His tag (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer GAAGGAGATATACATATGGAAC
  • 3′ sequencing primer CACTGAGGATCCGGCTGCTAAC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    synthesized by gescript

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    OfCasp3a was a gift from Clay Clark (Addgene plasmid # 166053 ; http://n2t.net/addgene:166053 ; RRID:Addgene_166053)
  • For your References section:

    Caspases from scleractinian coral show unique regulatory features. Shrestha S, Tung J, Grinshpon RD, Swartz P, Hamilton PT, Dimos B, Mydlarz L, Clark AC. J Biol Chem. 2020 Oct 23;295(43):14578-14591. doi: 10.1074/jbc.RA120.014345. Epub 2020 Aug 11. 10.1074/jbc.RA120.014345 PubMed 32788218