OfCasp3b
(Plasmid #166054)

• Purpose: a caspase of Orbicella faveolata, which has higher sequence similarity with human caspase-3 but function similar to caspase-6
• Depositing Lab: Clay Clark
• Publication: Shrestha et al J Biol Chem. 2020 Oct 23;295(43):14578-14591. doi: 10.1074/jbc.RA120.014345. Epub 2020 Aug 11.

Backbone

• Vector backbone: pET11a
• Backbone size w/o insert (bp): 5677
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Orbicella faveolata caspase-3b
• Alt name: OfCasp3b
• Species: Orbicella faveolata
• Insert Size (bp): 933
• Promoter: T7 lac promoter
• Tag / Fusion Protein:
  • His tag (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: GAAGGAGATATACATATGAGCT
• 3′ sequencing primer: TCACTGAGGATCCGGCTGCTAAC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: synthesized by gescript

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry