pROS13_IDH2 #7
(Plasmid
#166102)
-
PurposeThis plasmid express a sgRNA that targets the IDH2 gene. This allows Cas9 to make a double-strand break and facilitate integration of LOV2 at position IDH2-135 by homologous recombination.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 166102 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepROS13
-
Vector typeYeast Expression, CRISPR
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameIDH2 sgRNA #7
-
gRNA/shRNA sequenceTAAATCAACGTTTTCGTAAG
-
SpeciesS. cerevisiae (budding yeast)
-
Entrez GeneIDH2 (a.k.a. YOR136W)
Cloning Information
- Cloning method Gibson Cloning
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2021.05.25.445643v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pROS13_IDH2 #7 was a gift from Matthias Heinemann (Addgene plasmid # 166102 ; http://n2t.net/addgene:166102 ; RRID:Addgene_166102) -
For your References section:
A photo-switchable yeast isocitrate dehydrogenase to control metabolic flux through the citric acid cycle. Chen H, Mulder L, Wijma HJ, Wabeke R, Vila Cha Losa JP, Rovetta M, de Leeuw TC, Milias-Argeitis A, Heinemann M. bioRxiv 10.1101/2021.05.25.445643