pLenti KO Luc Firefly 2xgRNA - spCas9 iRFP670 puro
(Plasmid
#166134)
-
PurposeThis plasmid allows efficient KO of the firefly luciferase gene, while expressing the far red fluorescent protein iRFP670 and puromycin resistance
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 166134 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepLenti spCas9 T2A iRFP670 P2A puro
-
Backbone manufacturerAddgene #122182
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin, Zeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namehU6-gRNA and hH1-gRNA targeting firefly luciferase gene
-
Alt nameLuc
-
SpeciesP.pyralis
-
GenBank IDM15077.1
-
Tag
/ Fusion Protein
- iRFP670 (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmB1 (destroyed during cloning)
- 3′ cloning site BsmB1 (destroyed during cloning)
- 5′ sequencing primer gggtttattacagggacagcagag
- 3′ sequencing primer ggagccaattcccactcctttc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti KO Luc Firefly 2xgRNA - spCas9 iRFP670 puro was a gift from Raphael Gaudin (Addgene plasmid # 166134 ; http://n2t.net/addgene:166134 ; RRID:Addgene_166134) -
For your References section:
Occludin stalls HCV particle dynamics apart from hepatocyte tight junctions, promoting virion internalization. Deffieu MS, Clement CMH, Dorobantu CM, Partiot E, Bare Y, Faklaris O, Riviere B, Ayala-Nunez NV, Baumert TF, Ronde P, Mely Y, Lucansky V, Gaudin R. Hepatology. 2022 Apr 7. doi: 10.1002/hep.32514. 10.1002/hep.32514 PubMed 35388524