pdCas9_CL
(Plasmid
#166245)
-
Purposeregulated dCas9 generator
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 166245 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneBBa_J107202
- Total vector size (bp) 2603
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsTo successfully obtain the bacterial transformants of this plasmid, it required to use pAUX_OL plasmid.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameP112-sgRNA-term-P104-RBS1-dCas9-B15
-
Insert Size (bp)4574
- Promoter Ec-TTL-P112 and Ec-TTL-P104
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GGCGCGCCAAAAAGAGTATTG
- 3′ sequencing primer tataaacgcagaaaggcccacc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pdCas9_CL was a gift from Domitilla Del Vecchio (Addgene plasmid # 166245 ; http://n2t.net/addgene:166245 ; RRID:Addgene_166245) -
For your References section:
dCas9 regulator to neutralize competition in CRISPRi circuits. Huang HH, Bellato M, Qian Y, Cardenas P, Pasotti L, Magni P, Del Vecchio D. Nat Commun. 2021 Mar 16;12(1):1692. doi: 10.1038/s41467-021-21772-6. 10.1038/s41467-021-21772-6 PubMed 33727557