Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pdCas9_CL
(Plasmid #166245)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 166245 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    BBa_J107202
  • Total vector size (bp) 2603
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    To successfully obtain the bacterial transformants of this plasmid, it required to use pAUX_OL plasmid.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    P112-sgRNA-term-P104-RBS1-dCas9-B15
  • Insert Size (bp)
    4574
  • Promoter Ec-TTL-P112 and Ec-TTL-P104

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GGCGCGCCAAAAAGAGTATTG
  • 3′ sequencing primer tataaacgcagaaaggcccacc
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pdCas9_CL was a gift from Domitilla Del Vecchio (Addgene plasmid # 166245 ; http://n2t.net/addgene:166245 ; RRID:Addgene_166245)
  • For your References section:

    dCas9 regulator to neutralize competition in CRISPRi circuits. Huang HH, Bellato M, Qian Y, Cardenas P, Pasotti L, Magni P, Del Vecchio D. Nat Commun. 2021 Mar 16;12(1):1692. doi: 10.1038/s41467-021-21772-6. 10.1038/s41467-021-21772-6 PubMed 33727557