Skip to main content

pAUX_OL
(Plasmid #166246)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 166246 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pKD46
  • Total vector size (bp) 3212
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    This plasmid can be cured by growth at 37C because it has temperature-sensitive replicon.
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    [P112-sgRNA-term]-[J23116_B34-dCas9-B15]
  • Insert Size (bp)
    4618
  • Promoter Ec-TTL-P112 and BBa_J23116

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer catcgatttatgccacctgacgtc
  • 3′ sequencing primer tataaacgcagaaaggcccacc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAUX_OL was a gift from Domitilla Del Vecchio (Addgene plasmid # 166246 ; http://n2t.net/addgene:166246 ; RRID:Addgene_166246)
  • For your References section:

    dCas9 regulator to neutralize competition in CRISPRi circuits. Huang HH, Bellato M, Qian Y, Cardenas P, Pasotti L, Magni P, Del Vecchio D. Nat Commun. 2021 Mar 16;12(1):1692. doi: 10.1038/s41467-021-21772-6. 10.1038/s41467-021-21772-6 PubMed 33727557