pGEX-PP-NEDD4L-WW3(497-530)
(Plasmid
#166703)
-
Purposeexpresses NEDD4L WW3 in bacterial cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 166703 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepGEX-PP-GFP
- Backbone size w/o insert (bp) 5797
- Total vector size (bp) 5902
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameNEDD4L WW3 domain
-
SpeciesH. sapiens (human)
-
Insert Size (bp)105
- Promoter tac promoter
-
Tags
/ Fusion Proteins
- GST (C terminal on backbone)
- Thrombin site (C terminal on backbone)
- HRV 3C site (C terminal on backbone)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer GGGCTGGCAAGCCACGTTTGGTG
- 3′ sequencing primer CCGGGAGCTGCATGTGTCAGAGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGEX-PP-NEDD4L-WW3(497-530) was a gift from Wesley Sundquist (Addgene plasmid # 166703 ; http://n2t.net/addgene:166703 ; RRID:Addgene_166703) -
For your References section:
Interactions between AMOT PPxY Motifs and NEDD4L WW Domains Function in HIV-1 Release. Rheinemann L, Thompson T, Mercenne G, Paine EL, Peterson FC, Volkman BF, Alam SL, Alian A, Sundquist WI. J Biol Chem. 2021 Jul 17:100975. doi: 10.1016/j.jbc.2021.100975. 10.1016/j.jbc.2021.100975 PubMed 34284061