Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCI-Flag-NEDD4L∆WW1
(Plasmid #166707)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 166707 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCI-FLAG
  • Backbone size w/o insert (bp) 5842
  • Total vector size (bp) 8047
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    NEDD4L W221A
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2565
  • Mutation
    changed tryptophan 221 to alanine
  • Promoter CMV promoter
  • Tag / Fusion Protein
    • FLAG (N terminal on backbone)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGG
  • 3′ sequencing primer ATTAACCCTCACTAAAGGGA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCI-Flag-NEDD4L∆WW1 was a gift from Wesley Sundquist (Addgene plasmid # 166707 ; http://n2t.net/addgene:166707 ; RRID:Addgene_166707)
  • For your References section:

    Interactions between AMOT PPxY Motifs and NEDD4L WW Domains Function in HIV-1 Release. Rheinemann L, Thompson T, Mercenne G, Paine EL, Peterson FC, Volkman BF, Alam SL, Alian A, Sundquist WI. J Biol Chem. 2021 Jul 17:100975. doi: 10.1016/j.jbc.2021.100975. 10.1016/j.jbc.2021.100975 PubMed 34284061