pcDNA3HA-AMOT p130∆PPxY1(A112K)
(Plasmid
#166715)
-
Purposeexpresses AMOT(A112K) in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 166715 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA
- Backbone size w/o insert (bp) 5446
- Total vector size (bp) 8701
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameAngiomotin p130 A112K
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3255
-
Mutationchanged alanine 112 to lysine
-
Entrez GeneAMOT
- Promoter CMV promoter
-
Tag
/ Fusion Protein
- 2xHA (N terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TTAATACGACTCACTATAGGG
- 3′ sequencing primer AACTAGAAGGCACAGTCGAGGCTG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3HA-AMOT p130∆PPxY1(A112K) was a gift from Wesley Sundquist (Addgene plasmid # 166715 ; http://n2t.net/addgene:166715 ; RRID:Addgene_166715) -
For your References section:
Interactions between AMOT PPxY Motifs and NEDD4L WW Domains Function in HIV-1 Release. Rheinemann L, Thompson T, Mercenne G, Paine EL, Peterson FC, Volkman BF, Alam SL, Alian A, Sundquist WI. J Biol Chem. 2021 Jul 17:100975. doi: 10.1016/j.jbc.2021.100975. 10.1016/j.jbc.2021.100975 PubMed 34284061