pLenti-CMV-Puro-AAVR-FLAG
(Plasmid #166716)

• Purpose: Vector expressing AAVR (KIAA0319L) with a C-terminal Flag tag
• Depositing Lab: Jan Carette
• Publication: Pillay et al Nature. 2016 Feb 4;530(7588):108-12. doi: 10.1038/nature16465. Epub 2016 Jan 27.

Backbone

• Vector backbone: pLenti-CMV-Puro-DEST
• Backbone manufacturer: addgene plasmid #17452
• Backbone size w/o insert (bp): 9628
• Total vector size (bp): 11092
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: AAVR-FLAG
• Alt name: KIAA0319L
• Species: H. sapiens (human)
• Insert Size (bp): 3171
• GenBank ID: NM_024874.5
• Promoter: CMV
• Tag / Fusion Protein:
  • FLAG (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: gactctagtccagtgtggtg
• 3′ sequencing primer: atccagaggttgattgtcgag

Resource Information

• Supplemental Documents:
  • pLenti-CMV-Puro-AAVR-FLAG.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry