Skip to main content

pGMC00002
(Plasmid #166719)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 166719 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    Lenti-CRISPR-V2
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    BAP1
  • gRNA/shRNA sequence
    CCTCATCGCAGGTGTCAAGG
  • Species
    H. sapiens (human)
  • Entrez Gene
    BAP1 (a.k.a. HUCEP-13, KURIS, TPDS1, UBM2, UCHL2, UVM2, hucep-6)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGMC00002 was a gift from Raj Chari (Addgene plasmid # 166719 ; http://n2t.net/addgene:166719 ; RRID:Addgene_166719)
  • For your References section:

    Sensitivity of Mesothelioma Cells to PARP Inhibitors Is Not Dependent on BAP1 but Is Enhanced by Temozolomide in Cells With High-Schlafen 11 and Low-O6-methylguanine-DNA Methyltransferase Expression. Rathkey D, Khanal M, Murai J, Zhang J, Sengupta M, Jiang Q, Morrow B, Evans CN, Chari R, Fetsch P, Chung HJ, Xi L, Roth M, Filie A, Raffeld M, Thomas A, Pommier Y, Hassan R. J Thorac Oncol. 2020 May;15(5):843-859. doi: 10.1016/j.jtho.2020.01.012. Epub 2020 Jan 28. 10.1016/j.jtho.2020.01.012 PubMed 32004714