pGMC00002
(Plasmid
#166719)
-
PurposesgRNA against human BAP1
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 166719 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneLenti-CRISPR-V2
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBAP1
-
gRNA/shRNA sequenceCCTCATCGCAGGTGTCAAGG
-
SpeciesH. sapiens (human)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGMC00002 was a gift from Raj Chari (Addgene plasmid # 166719 ; http://n2t.net/addgene:166719 ; RRID:Addgene_166719) -
For your References section:
Sensitivity of Mesothelioma Cells to PARP Inhibitors Is Not Dependent on BAP1 but Is Enhanced by Temozolomide in Cells With High-Schlafen 11 and Low-O6-methylguanine-DNA Methyltransferase Expression. Rathkey D, Khanal M, Murai J, Zhang J, Sengupta M, Jiang Q, Morrow B, Evans CN, Chari R, Fetsch P, Chung HJ, Xi L, Roth M, Filie A, Raffeld M, Thomas A, Pommier Y, Hassan R. J Thorac Oncol. 2020 May;15(5):843-859. doi: 10.1016/j.jtho.2020.01.012. Epub 2020 Jan 28. 10.1016/j.jtho.2020.01.012 PubMed 32004714
