Skip to main content

pGMC00006
(Plasmid #166723)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 166723 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    Lenti-CRISPR-V2
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ASNS
  • gRNA/shRNA sequence
    GATCGAACTACTGCTGCCCA
  • Species
    H. sapiens (human)
  • Entrez Gene
    ASNS (a.k.a. ASNSD, TS11)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGMC00006 was a gift from Raj Chari (Addgene plasmid # 166723 ; http://n2t.net/addgene:166723 ; RRID:Addgene_166723)
  • For your References section:

    Metabolic plasticity of IDH1-mutant glioma cell lines is responsible for low sensitivity to glutaminase inhibition. Ruiz-Rodado V, Lita A, Dowdy T, Celiku O, Saldana AC, Wang H, Yang CZ, Chari R, Li A, Zhang W, Song H, Zhang M, Ahn S, Davis D, Chen X, Zhuang Z, Herold-Mende C, Walters KJ, Gilbert MR, Larion M. Cancer Metab. 2020 Oct 21;8:23. doi: 10.1186/s40170-020-00229-2. eCollection 2020. 10.1186/s40170-020-00229-2 PubMed 33101674