pGMC00006
(Plasmid
#166723)
-
PurposesgRNA against human ASNS
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 166723 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneLenti-CRISPR-V2
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameASNS
-
gRNA/shRNA sequenceGATCGAACTACTGCTGCCCA
-
SpeciesH. sapiens (human)
-
Entrez GeneASNS (a.k.a. ASNSD, TS11)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGMC00006 was a gift from Raj Chari (Addgene plasmid # 166723 ; http://n2t.net/addgene:166723 ; RRID:Addgene_166723) -
For your References section:
Metabolic plasticity of IDH1-mutant glioma cell lines is responsible for low sensitivity to glutaminase inhibition. Ruiz-Rodado V, Lita A, Dowdy T, Celiku O, Saldana AC, Wang H, Yang CZ, Chari R, Li A, Zhang W, Song H, Zhang M, Ahn S, Davis D, Chen X, Zhuang Z, Herold-Mende C, Walters KJ, Gilbert MR, Larion M. Cancer Metab. 2020 Oct 21;8:23. doi: 10.1186/s40170-020-00229-2. eCollection 2020. 10.1186/s40170-020-00229-2 PubMed 33101674