pCSN072
(Plasmid
#166730)
-
PurposeSingle copy yeast plasmid expressing DNase-dead dLbCas12a E925A fused to NLS, Mxi1 and NLS, codon optimized for Saccharomyces cerevisiae
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 166730 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepRS414
- Backbone size w/o insert (bp) 7206
- Total vector size (bp) 11136
-
Vector typeYeast Expression, CRISPR
-
Selectable markersTRP1 ; KanMX
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namedCas12a-NLS-Mxi1-NLS
-
Alt namedCpf1-NLS-Mxi1-NLS
-
SpeciesSynthetic; Lachnospiraceae bacterium ND2006
-
Insert Size (bp)3930
-
MutationE925A
- Promoter S. cerevisiae TEF1
-
Tags
/ Fusion Proteins
- SV40 NLS (C terminal on insert)
- Mxi1 (C terminal on insert)
- SV40 NLS (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ATGTCTAAGTTGGAAAAATTCACCA
- 3′ sequencing primer TTATACCTTTCTCTTCTTCTTTGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCSN072 was a gift from Rene Verwaal (Addgene plasmid # 166730 ; http://n2t.net/addgene:166730 ; RRID:Addgene_166730) -
For your References section:
Efficient multiplexed gene regulation in Saccharomyces cerevisiae using dCas12a. Ciurkot K, Gorochowski TE, Roubos JA, Verwaal R. Nucleic Acids Res. 2021 Jul 1. pii: 6312738. doi: 10.1093/nar/gkab529. 10.1093/nar/gkab529 PubMed 34197613