Venus-Bik-pEGFP-C1
(Plasmid #166737)

• Purpose: Express Venus fused to the N-terminus of the Bcl-2 family protein, Bik
• Depositing Lab: David Andrews
• Depositing Organization: Sunnybrook Research Institute
  Located in Canada
• Publication: Osterlund et al Sci Adv. 2022 Apr 22;8(16):eabm7375. doi: 10.1126/sciadv.abm7375. Epub 2022 Apr 20.

Backbone

• Vector backbone: pEGFP-C1
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Bik
• Alt name: Bcl-2-interacting killer, or Apoptosis inducer NBK
• Species: H. sapiens (human)
• Entrez Gene: BIK (a.k.a. BIP1, BP4, NBK)
• Promoter: CMV
• Tag / Fusion Protein:
  • Venus (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Unknown (unknown if destroyed)
• 3′ cloning site: Unknown (unknown if destroyed)
• 5′ sequencing primer: TGACGCAAATGGGCGGTAGG
• 3′ sequencing primer: TCGCCCTTTGACGTTGGAGTCCAC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Bik sequence aligns with Homo sapiens BCL2 interacting killer (BIK), mRNA; NCBI Reference Sequence: NM_001197.5.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Transfection of this plasmid will express "VBik" (Venus fused to the N-terminus of the BH3-only protein, Bik) in live cells. There is an 8 amino acid flexible linker between Venus and Bik proteins. When compared with EYFP, Venus fluorophore contains the following mutations: F46L, F64L, M153T, V163A and S175G. This Venus protein contains an F224R mutation to make it monomeric.

DNA (Catalog # 166737-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 166737-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.