Skip to main content
Addgene

Venus-BimEL(Noxa)-pEGFP-C1
(Plasmid #166761)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 166761 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEGFP-C1
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    BimEL(Mus musculus)-(Noxa BH3)
  • Alt name
    BimEL-Noxa, BimEL(Noxa BH3), VBimEL(Noxa), VBimEL(Noxa BH3)
  • Species
    H. sapiens (human), M. musculus (mouse)
  • Mutation
    BH3 region removed and inserted BH3 of human Noxa protein
  • Entrez Gene
    Bcl2l11 (a.k.a. 1500006F24Rik, Bim, Bod, bcl2-L-11)
  • Entrez Gene
    PMAIP1 (a.k.a. APR, NOXA)
  • Promoter CMV
  • Tag / Fusion Protein
    • Venus (N terminal on backbone)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer TGACGCAAATGGGCGGTAGG
  • 3′ sequencing primer TCGCCCTTTGACGTTGGAGTCCAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

BH3 region removed and inserted BH3 of Noxa protein. There is a K107E mutation in the Venus sequence of this plasmid. The K107E mutation is facing outwards in the B-Barrel structure of the Venus protein. Therefore, it is unlikely that this mutation would affect the chromophore within the β-barrel. We have transfected this plasmid in BMK-DKO cells and did not observe aggregation. We also used this construct and observed Forster resonance energy transfer from mCerulean3 in the context of measuring interactions with two binding partners. Thus, this mutation does not appear to affect the Venus fluorophore.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Venus-BimEL(Noxa)-pEGFP-C1 was a gift from David Andrews (Addgene plasmid # 166761 ; http://n2t.net/addgene:166761 ; RRID:Addgene_166761)
  • For your References section:

    Efficacy and specificity of inhibitors of BCL-2 family protein interactions assessed by affinity measurements in live cells. Osterlund EJ, Hirmiz N, Pemberton JM, Nougarede A, Liu Q, Leber B, Fang Q, Andrews DW. Sci Adv. 2022 Apr 22;8(16):eabm7375. doi: 10.1126/sciadv.abm7375. Epub 2022 Apr 20. 10.1126/sciadv.abm7375 PubMed 35442739