Venus-BimEL(Noxa)-pEGFP-C1
(Plasmid
#166761)
-
PurposeTo examine effect of swapping the BH3 region in full length BimEL with that of Noxa
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 166761 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEGFP-C1
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBimEL(Mus musculus)-(Noxa BH3)
-
Alt nameBimEL-Noxa, BimEL(Noxa BH3), VBimEL(Noxa), VBimEL(Noxa BH3)
-
SpeciesH. sapiens (human), M. musculus (mouse)
-
MutationBH3 region removed and inserted BH3 of human Noxa protein
-
Entrez GeneBcl2l11 (a.k.a. 1500006F24Rik, Bim, Bod, bcl2-L-11)
-
Entrez GenePMAIP1 (a.k.a. APR, NOXA)
- Promoter CMV
-
Tag
/ Fusion Protein
- Venus (N terminal on backbone)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TGACGCAAATGGGCGGTAGG
- 3′ sequencing primer TCGCCCTTTGACGTTGGAGTCCAC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
BH3 region removed and inserted BH3 of Noxa protein. There is a K107E mutation in the Venus sequence of this plasmid. The K107E mutation is facing outwards in the B-Barrel structure of the Venus protein. Therefore, it is unlikely that this mutation would affect the chromophore within the β-barrel. We have transfected this plasmid in BMK-DKO cells and did not observe aggregation. We also used this construct and observed Forster resonance energy transfer from mCerulean3 in the context of measuring interactions with two binding partners. Thus, this mutation does not appear to affect the Venus fluorophore.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Venus-BimEL(Noxa)-pEGFP-C1 was a gift from David Andrews (Addgene plasmid # 166761 ; http://n2t.net/addgene:166761 ; RRID:Addgene_166761) -
For your References section:
Efficacy and specificity of inhibitors of BCL-2 family protein interactions assessed by affinity measurements in live cells. Osterlund EJ, Hirmiz N, Pemberton JM, Nougarede A, Liu Q, Leber B, Fang Q, Andrews DW. Sci Adv. 2022 Apr 22;8(16):eabm7375. doi: 10.1126/sciadv.abm7375. Epub 2022 Apr 20. 10.1126/sciadv.abm7375 PubMed 35442739