Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pIA1385
(Plasmid #166862)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 166862 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    SARS-COV-2 Nsp12
  • Species
    Synthetic
  • Insert Size (bp)
    2821
  • GenBank ID
  • Entrez Gene
    ORF1ab (a.k.a. GU280_gp01)
  • Promoter T7
  • Tag / Fusion Protein
    • His-SUMO (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pIA1385 was a gift from Irina Artsimovitch (Addgene plasmid # 166862 ; http://n2t.net/addgene:166862 ; RRID:Addgene_166862)
  • For your References section:

    Allosteric Activation of SARS-CoV-2 RNA-Dependent RNA Polymerase by Remdesivir Triphosphate and Other Phosphorylated Nucleotides. Wang B, Svetlov V, Wolf YI, Koonin EV, Nudler E, Artsimovitch I. mBio. 2021 Jun 29;12(3):e0142321. doi: 10.1128/mBio.01423-21. Epub 2021 Jun 22. 10.1128/mBio.01423-21 PubMed 34154407