Skip to main content

pLKO-Tet-On-AHR-shRNA3
(Plasmid #166909)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 166909 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLKO-TET-ON-addgene#21915
  • Backbone size w/o insert (bp) 11000
  • Total vector size (bp) 9000
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    AHR shRNA
  • Alt name
    AHR
  • gRNA/shRNA sequence
    CGGCATAGAGACCGACTTAAT
  • Species
    H. sapiens (human)
  • Entrez Gene
    AHR (a.k.a. RP85, bHLHe76)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (destroyed during cloning)
  • 3′ cloning site EcoRI (destroyed during cloning)
  • 5′ sequencing primer pLKO-seq: ggcagggatattcaccattatcgtttcaga
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2023.11.04.565649 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO-Tet-On-AHR-shRNA3 was a gift from Roland Friedel (Addgene plasmid # 166909 ; http://n2t.net/addgene:166909 ; RRID:Addgene_166909)
  • For your References section:

    Aryl hydrocarbon receptor restricts axon regeneration of DRG neurons in response to injury. Halawani D, Wang Y, Estill M, Sefiani A, Ramakrishnan A, Li J, Ni H, Halperin D, Shen L, Geoffroy CG, Friedel RH, Zou H. bioRxiv [Preprint]. 2024 Sep 14:2023.11.04.565649. doi: 10.1101/2023.11.04.565649. 10.1101/2023.11.04.565649 PubMed 37961567