pLKO-Tet-On-AHR-shRNA3
(Plasmid
#166909)
-
PurposeLentivirus for inducible knockdown of human AHR
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 166909 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLKO-TET-ON-addgene#21915
- Backbone size w/o insert (bp) 11000
- Total vector size (bp) 9000
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAHR shRNA
-
Alt nameAHR
-
gRNA/shRNA sequenceCGGCATAGAGACCGACTTAAT
-
SpeciesH. sapiens (human)
-
Entrez GeneAHR (a.k.a. RP85, bHLHe76)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (destroyed during cloning)
- 3′ cloning site EcoRI (destroyed during cloning)
- 5′ sequencing primer pLKO-seq: ggcagggatattcaccattatcgtttcaga
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2023.11.04.565649 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO-Tet-On-AHR-shRNA3 was a gift from Roland Friedel (Addgene plasmid # 166909 ; http://n2t.net/addgene:166909 ; RRID:Addgene_166909) -
For your References section:
Aryl hydrocarbon receptor restricts axon regeneration of DRG neurons in response to injury. Halawani D, Wang Y, Estill M, Sefiani A, Ramakrishnan A, Li J, Ni H, Halperin D, Shen L, Geoffroy CG, Friedel RH, Zou H. bioRxiv [Preprint]. 2024 Sep 14:2023.11.04.565649. doi: 10.1101/2023.11.04.565649. 10.1101/2023.11.04.565649 PubMed 37961567