Skip to main content

pLKO-Tet-On-ARNT-shRNA1
(Plasmid #166910)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 166910 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLKO-TET-ON-addgene#21915
  • Backbone size w/o insert (bp) 11000
  • Total vector size (bp) 9000
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ARNT shRNA
  • Alt name
    ARNT
  • gRNA/shRNA sequence
    GAGAAGTCAGATGGTTTATTT
  • Species
    H. sapiens (human)
  • Entrez Gene
    ARNT (a.k.a. ARNT1, HIF-1-beta, HIF-1beta, HIF1-beta, HIF1B, HIF1BETA, TANGO, bHLHe2)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (destroyed during cloning)
  • 3′ cloning site EcoRI (destroyed during cloning)
  • 5′ sequencing primer pLKO-seq: ggcagggatattcaccattatcgtttcaga
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO-Tet-On-ARNT-shRNA1 was a gift from Roland Friedel (Addgene plasmid # 166910 ; http://n2t.net/addgene:166910 ; RRID:Addgene_166910)
  • For your References section:

    Circadian clock regulator Bmal1 gates axon regeneration via Tet3 epigenetics in mouse sensory neurons. Halawani D, Wang Y, Ramakrishnan A, Estill M, He X, Shen L, Friedel RH, Zou H. Nat Commun. 2023 Aug 24;14(1):5165. doi: 10.1038/s41467-023-40816-7. 10.1038/s41467-023-40816-7 PubMed 37620297