pSTAR2
(Plasmid
#166940)
-
PurposeSTAR-based multi-level gene expression controller (MLC)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 166940 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBR322
- Backbone size w/o insert (bp) 1704
- Total vector size (bp) 4373
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameCircuit expressing GFP- Small transcription activating RNAs
-
Alt nameSTAR 2
-
SpeciesSynthetic
- Promoter PTAC
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer aaacaaataggggttccgcg
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSTAR2 was a gift from Thomas Gorochowski (Addgene plasmid # 166940 ; http://n2t.net/addgene:166940 ; RRID:Addgene_166940) -
For your References section:
Harnessing the central dogma for stringent multi-level control of gene expression. Greco FV, Pandi A, Erb TJ, Grierson CS, Gorochowski TE. Nat Commun. 2021 Mar 19;12(1):1738. doi: 10.1038/s41467-021-21995-7. 10.1038/s41467-021-21995-7 PubMed 33741937