pAAV-Syn1-FLEX-mCh-T2A-FLAG-hMOR-WPRE
(Plasmid
#166970)
-
PurposeCre-dependent viral expression of the human mu opioid receptor (hMOR/Oprm1) and mCherry. hMOR contains an N-terminal FLAG tag.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 166970 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV-Syn1-FLEX-WPRE
-
Backbone manufacturerVector Builder
- Backbone size w/o insert (bp) 4500
- Total vector size (bp) 6500
-
Vector typeMammalian Expression, AAV, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHomo sapiens opioid receptor mu 1 (OPRM1)
-
Alt namehMOR
-
Alt nameMOP
-
Alt nameMOPR
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2004
-
GenBank IDNM_000914.5 Gene ID 4988
-
Entrez GeneOPRM1 (a.k.a. LMOR, M-OR-1, MOP, MOR, MOR1, OPRM)
- Promoter hsyn
-
Tags
/ Fusion Proteins
- FLAG (N terminal on insert)
- T2A (N terminal on insert)
- mCherry (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GACTCAGCGCTGCCTCAGTCTG
- 3′ sequencing primer GCGTAAAAGGAGCAACATAGTTAAGA (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byVector Builder
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-Syn1-FLEX-mCh-T2A-FLAG-hMOR-WPRE was a gift from Matthew Banghart (Addgene plasmid # 166970 ; http://n2t.net/addgene:166970 ; RRID:Addgene_166970) -
For your References section:
Neural basis of opioid-induced respiratory depression and its rescue. Liu S, Kim DI, Oh TG, Pao GM, Kim JH, Palmiter RD, Banghart MR, Lee KF, Evans RM, Han S. Proc Natl Acad Sci U S A. 2021 Jun 8;118(23). pii: 2022134118. doi: 10.1073/pnas.2022134118. 10.1073/pnas.2022134118 PubMed 34074761