Skip to main content

pAAV-Syn1-FLEX-mCh-T2A-FLAG-hMOR-WPRE
(Plasmid #166970)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 166970 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV-Syn1-FLEX-WPRE
  • Backbone manufacturer
    Vector Builder
  • Backbone size w/o insert (bp) 4500
  • Total vector size (bp) 6500
  • Vector type
    Mammalian Expression, AAV, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Homo sapiens opioid receptor mu 1 (OPRM1)
  • Alt name
    hMOR
  • Alt name
    MOP
  • Alt name
    MOPR
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2004
  • GenBank ID
    NM_000914.5 Gene ID 4988
  • Entrez Gene
    OPRM1 (a.k.a. LMOR, M-OR-1, MOP, MOR, MOR1, OPRM)
  • Promoter hsyn
  • Tags / Fusion Proteins
    • FLAG (N terminal on insert)
    • T2A (N terminal on insert)
    • mCherry (N terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer GACTCAGCGCTGCCTCAGTCTG
  • 3′ sequencing primer GCGTAAAAGGAGCAACATAGTTAAGA
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Vector Builder
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-Syn1-FLEX-mCh-T2A-FLAG-hMOR-WPRE was a gift from Matthew Banghart (Addgene plasmid # 166970 ; http://n2t.net/addgene:166970 ; RRID:Addgene_166970)
  • For your References section:

    Neural basis of opioid-induced respiratory depression and its rescue. Liu S, Kim DI, Oh TG, Pao GM, Kim JH, Palmiter RD, Banghart MR, Lee KF, Evans RM, Han S. Proc Natl Acad Sci U S A. 2021 Jun 8;118(23). pii: 2022134118. doi: 10.1073/pnas.2022134118. 10.1073/pnas.2022134118 PubMed 34074761