-
PurposeExpresses ER targeted TurboID for secretome biotinylation
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 166971 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA5
- Backbone size w/o insert (bp) 5082
- Total vector size (bp) 6393
-
Vector typeMammalian Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSec61b-V5-TurboID
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1311
-
GenBank IDNM_006808.2
- Promoter CMV promoter
-
Tag
/ Fusion Protein
- V5 (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Sec61b-V5-TurboID was a gift from Hyun-Woo Rhee (Addgene plasmid # 166971 ; http://n2t.net/addgene:166971 ; RRID:Addgene_166971) -
For your References section:
Dynamic tracking and identification of tissue-specific secretory proteins in the circulation of live mice. Kim KE, Park I, Kim J, Kang MG, Choi WG, Shin H, Kim JS, Rhee HW, Suh JM. Nat Commun. 2021 Sep 1;12(1):5204. doi: 10.1038/s41467-021-25546-y. 10.1038/s41467-021-25546-y PubMed 34471136