pCas9CyMutL
(Plasmid #166981)

• Purpose: Encodes aTc-inducible spCas9 and cumate-inducible MutLE32K for transient suppression of mismatch repair
• Depositing Lab: Christopher Reisch
• Publication: Ellington et al Synth Biol (Oxf). 2022 May 3;7(1):ysac007. doi: 10.1093/synbio/ysac007. eCollection 2022.

Backbone

• Vector backbone: pCas9CR4
• Backbone manufacturer: Christopher Reisch
• Total vector size (bp): 9681
• Vector type: Bacterial Expression, CRISPR, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: MutL
• Mutation: E32K
• Entrez Gene: mutL (a.k.a. b4170, ECK4166)
• Promoter: pCymRC

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CGCAGCTCTGGCTGCTTAAC
• 3′ sequencing primer: CACGACAGGTTTCCCGACTGGAAAGC

Gene/Insert 2

• Gene/Insert name: CymR
• Species: Synthetic
• Insert Size (bp): 992
• Promoter: pLacI

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: cctagggatatattccgcttcc

Resource Information

• A portion of this plasmid was derived from a plasmid made by: CymR from pAJM.847 (item#108524; Meyer et al Nat Chem Biol. 2018 Nov 26. pii: 10.1038)
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry