pCas9CyMutL
(Plasmid
#166981)
-
PurposeEncodes aTc-inducible spCas9 and cumate-inducible MutLE32K for transient suppression of mismatch repair
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 166981 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepCas9CR4
-
Backbone manufacturerChristopher Reisch
- Total vector size (bp) 9681
-
Vector typeBacterial Expression, CRISPR, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameMutL
-
MutationE32K
-
Entrez GenemutL (a.k.a. b4170, ECK4166)
- Promoter pCymRC
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAGCTCTGGCTGCTTAAC
- 3′ sequencing primer CACGACAGGTTTCCCGACTGGAAAGC
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameCymR
-
SpeciesSynthetic
-
Insert Size (bp)992
- Promoter pLacI
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer cctagggatatattccgcttcc
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byCymR from pAJM.847 (item#108524; Meyer et al Nat Chem Biol. 2018 Nov 26. pii: 10.1038)
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCas9CyMutL was a gift from Christopher Reisch (Addgene plasmid # 166981 ; http://n2t.net/addgene:166981 ; RRID:Addgene_166981) -
For your References section:
Efficient and iterative retron-mediated in vivo recombineering in Escherichia coli. Ellington AJ, Reisch CR. Synth Biol (Oxf). 2022 May 3;7(1):ysac007. doi: 10.1093/synbio/ysac007. eCollection 2022. 10.1093/synbio/ysac007 PubMed 35673614