Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

(Plasmid #31491)


Item Catalog # Description Quantity Price (USD)
Plasmid 31491 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 5400
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
    RNA polymerase
  • Alt name
    T7 RNA polymerase
  • Species
    T7 phage
  • Insert Size (bp)
  • Mutation

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Sac1 (not destroyed)
  • 3′ cloning site Xba1 (not destroyed)
  • 5′ sequencing primer ATGCCATAGCATTTTTATCC
  • 3′ sequencing primer GATTTAATCTGTATCAGG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    pAR1219 encoded T7 polymerase, obtained from Ian Molineux, University of Texas; pBAD33 was obtained from L. Guzman
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

For expression: E. coli CV2

N823D mutation should not affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTARA was a gift from Kathleen Matthews (Addgene plasmid # 31491 ; ; RRID:Addgene_31491)
  • For your References section:

    Generation of an AraC-araBAD promoter-regulated T7 expression system. Wycuff DR, Matthews KS. Anal Biochem. 2000 Jan 1. 277(1):67-73. 10.1006/abio.1999.4385 PubMed 10610690