pENTR1A-3xFlag-M694V-MEFV
(Plasmid
#167118)
-
PurposeGateway entry plasmid with 3xFlag-pyrin (M694V/FMF variant)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 167118 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEntr1A
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 3800
- Total vector size (bp) 4710
-
Modifications to backboneremoval of CddB-Cm resistance cassette. Introduction Kpn1-3xFlag-Not1-MEFVp.S242R-Xho1
-
Vector typegateway entry vector
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMEFV
-
Alt namepyrin
-
SpeciesH. sapiens (human)
-
MutationM694V Methionine 694 to valine (FMF mutation)
-
Entrez GeneMEFV (a.k.a. FMF, MEF, PAAND, TRIM20)
-
Tag
/ Fusion Protein
- 3xFlag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Not1 (not destroyed)
- 3′ cloning site xho1 (not destroyed)
- 5′ sequencing primer TAGTTACTTAAGCTCGGGCCCC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pENTR1A-3xFlag-M694V-MEFV was a gift from Thomas Henry (Addgene plasmid # 167118 ; http://n2t.net/addgene:167118 ; RRID:Addgene_167118) -
For your References section:
Functional Assessment of Disease-Associated Pyrin Variants. Chirita D, Jamilloux Y, Henry T, Magnotti F. Methods Mol Biol. 2022;2523:179-195. doi: 10.1007/978-1-0716-2449-4_12. 10.1007/978-1-0716-2449-4_12 PubMed 35759198