p35S_EVDm1
(Plasmid
#167121)
-
PurposePlant binary expression vector containing the coding sequence of the Arabidopsis Copia93 retroelement EVADE (AT5G17125) with U1 binding site mutated under CaMV 35S promoter.
-
Depositing Labs
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 167121 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepB7m34GW
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 8000
- Total vector size (bp) 13470
-
Vector typePlant Expression
-
Selectable markersBasta
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEVADE (EVD)
-
Alt nameCopia93
-
Alt nameAT5TE20395
-
Alt nameAT5G17125
-
SpeciesA. thaliana (mustard weed)
-
Insert Size (bp)4215
-
Mutationmutated four nucleotides at the snoRNA U1 binding site from the 5'splice donor site to prevent splicing
-
GenBank IDNC_003076.8
-
Entrez GeneAT5G17125 (a.k.a. AT5G17125)
- Promoter CaMV 35S
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer TTCGACGGAGAAGGTGACGATAC
- 3′ sequencing primer TTGGTGAAGATATCCGCCAACTG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p35S_EVDm1 was a gift from Arturo Marí-Ordóñez & Olivier Voinnet (Addgene plasmid # 167121 ; http://n2t.net/addgene:167121 ; RRID:Addgene_167121) -
For your References section:
A genome-wide transcriptome and translatome analysis of Arabidopsis transposons identifies a unique and conserved genome expression strategy for Ty1/Copia retroelements. Oberlin S, Sarazin A, Chevalier C, Voinnet O, Mari-Ordonez A. Genome Res. 2017 Sep;27(9):1549-1562. doi: 10.1101/gr.220723.117. Epub 2017 Aug 7. 10.1101/gr.220723.117 PubMed 28784835