pBJ6
(Plasmid
#167135)
-
PurposeA gentamycin resistant plasmid for Tn7-mediated chromosomal integration of Photorhabdus luminescens luxCDABE operon with Pkan promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 167135 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBBRMCS-5
-
Backbone manufacturerKenneth M. Peterson
-
Vector typeBacterial Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Gentamicin, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameluxCDABE
-
SpeciesPhotorhabdus luminescens
-
Insert Size (bp)7600
- Promoter Kanamycin promoter
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GACAATATTATGCAACCGTA (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bytnsABCD and luxCDABE genes were amplified from pBEN276 (Addgene plasmid #69150).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBJ6 was a gift from Akira Mine (Addgene plasmid # 167135 ; http://n2t.net/addgene:167135 ; RRID:Addgene_167135) -
For your References section:
A versatile Tn7 transposon-based bioluminescence tagging tool for quantitative and spatial detection of bacteria in plants. Matsumoto A, Schluter T, Melkonian K, Takeda A, Nakagami H, Mine A. Plant Commun. 2021 Jul 20;3(1):100227. doi: 10.1016/j.xplc.2021.100227. eCollection 2022 Jan 10. 10.1016/j.xplc.2021.100227 PubMed 35059625