pAB120
(Plasmid
#167150)
-
PurposeMoClo-compatible Level 1 (position 1) vector encoding Kanamycin resistance cassette, for expression in plants
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 167150 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneLevel1-like (position 1)
- Backbone size w/o insert (bp) 4376
-
Vector typePlant Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepNOS-nptII-ocsT
-
SpeciesEscherichia coli
-
Insert Size (bp)1867
- Promoter pNOS
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer ggtggcaggatatattgtggtgtaaac
- 3′ sequencing primer ttcacgcccttttaaatatcc (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bySynthetic
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAB120 was a gift from Karen Sarkisyan (Addgene plasmid # 167150 ; http://n2t.net/addgene:167150 ; RRID:Addgene_167150) -
For your References section:
Plants with genetically encoded autoluminescence. Mitiouchkina T, Mishin AS, Somermeyer LG, Markina NM, Chepurnyh TV, Guglya EB, Karataeva TA, Palkina KA, Shakhova ES, Fakhranurova LI, Chekova SV, Tsarkova AS, Golubev YV, Negrebetsky VV, Dolgushin SA, Shalaev PV, Shlykov D, Melnik OA, Shipunova VO, Deyev SM, Bubyrev AI, Pushin AS, Choob VV, Dolgov SV, Kondrashov FA, Yampolsky IV, Sarkisyan KS. Nat Biotechnol. 2020 Apr 27. pii: 10.1038/s41587-020-0500-9. doi: 10.1038/s41587-020-0500-9. 10.1038/s41587-020-0500-9 PubMed 32341562