pDS1928
(Plasmid
#167284)
-
PurposeExpression plasmid for Candida albicans containing a red-shifted luciferase
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 167284 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBluescript
-
Selectable markersNourseothricin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namered shifted luciferase
-
SpeciesSynthetic
-
Insert Size (bp)1653
- Promoter ACT1
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site PstI (not destroyed)
- 5′ sequencing primer AATTAACCCTCACTAAAGGG
- 3′ sequencing primer CGTTCTTAATACTAACATAACT
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameSAT1
-
Alt namedominant marker
-
Insert Size (bp)1828
- Promoter ACT1
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (destroyed during cloning)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer TTTAAGGATAATGATCTGGG
- 3′ sequencing primer CGACTCACTATAGGGCGAAT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDS1928 was a gift from Dominique Sanglard (Addgene plasmid # 167284 ; http://n2t.net/addgene:167284 ; RRID:Addgene_167284) -
For your References section:
Red-Shifted Firefly Luciferase Optimized for Candida albicans In vivo Bioluminescence Imaging. Dorsaz S, Coste AT, Sanglard D. Front Microbiol. 2017 Aug 3;8:1478. doi: 10.3389/fmicb.2017.01478. eCollection 2017. 10.3389/fmicb.2017.01478 PubMed 28824601