Skip to main content

pBCMV-MS2CP-eDHFR
(Plasmid #167309)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 167309 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3.1+/C-(K)DYK (partial)
  • Backbone manufacturer
    Genscript
  • Total vector size (bp) 7510
  • Modifications to backbone
    Outside of CMV promoter-Kan/Neo resistance gene region is replaced by the piggyBac vector-derived sequence.
  • Vector type
    Mammalian Expression, Synthetic Biology
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    MS2CP-eDHFR
  • Alt name
    Fusion protein of MS2 coat protein and Escherichia coli dihydrofolate reductase
  • Species
    Synthetic
  • Insert Size (bp)
    876
  • Promoter CMV
  • Tag / Fusion Protein
    • DYK-tag (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site AgeI (not destroyed)
  • 5′ sequencing primer None
  • 3′ sequencing primer TCACTTATCGTCGTCATCCTTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBCMV-MS2CP-eDHFR was a gift from Hirohide Saito (Addgene plasmid # 167309 ; http://n2t.net/addgene:167309 ; RRID:Addgene_167309)
  • For your References section:

    Light-controllable RNA-protein devices for translational regulation of synthetic mRNAs in mammalian cells. Nakanishi H, Yoshii T, Kawasaki S, Hayashi K, Tsutsui K, Oki C, Tsukiji S, Saito H. Cell Chem Biol. 2021 Jan 20. pii: S2451-9456(21)00002-7. doi: 10.1016/j.chembiol.2021.01.002. 10.1016/j.chembiol.2021.01.002 PubMed 33508227