Skip to main content

pCDH_CMV_L6_mKate2
(Plasmid #167332)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 167332 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCDH-CMV-MCS
  • Backbone manufacturer
    Addgene
  • Backbone size w/o insert (bp) 6227
  • Total vector size (bp) 7662
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TFAM
  • Alt name
    Mitochondrial transcription factor A
  • Species
    H. sapiens (human)
  • Mutation
    Changed K136, H137, K139, R140, K146 and K147 to alanine
  • GenBank ID
    NM_003201.3
  • Entrez Gene
    TFAM (a.k.a. MTDPS15, MTTF1, MTTFA, TCF6, TCF6L1, TCF6L2, TCF6L3)
  • Promoter CMV
  • Tag / Fusion Protein
    • mKate2 (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Xba (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Addgene; Applied Biological Materials Inc. (abm)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The L6 mutant TFAM gene was originally obtained from Addgene Plasmid #60012. The mKate2 gene was initially obtained from the commercially available plasmid: pLenti-GIII-CMV-TFAM-RFP-2A-Puro. Please visit https://www.biorxiv.org/content/10.1101/822858v4 for BioRxiv preprint

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCDH_CMV_L6_mKate2 was a gift from Tom Misteli (Addgene plasmid # 167332 ; http://n2t.net/addgene:167332 ; RRID:Addgene_167332)
  • For your References section:

    Self-assembly of multi-component mitochondrial nucleoids via phase separation. Feric M, Demarest TG, Tian J, Croteau DL, Bohr VA, Misteli T. EMBO J. 2021 Mar 15;40(6):e107165. doi: 10.15252/embj.2020107165. Epub 2021 Feb 23. 10.15252/embj.2020107165 PubMed 33619770