pcDNA3.1-3XHA-Zmat3R99Q
(Plasmid
#167344)
-
PurposeExpresses HA-tagged R99Q mutant Zmat3
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 167344 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.1
- Backbone size w/o insert (bp) 5428
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameZinc finger matrin-type 3
-
Alt nameZmat3, Wig1, PAG608
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)900
-
Mutationchanged arginine 99 to glutamine
-
Entrez GeneZmat3 (a.k.a. Wig, Wig1)
- Promoter CMV
-
Tag
/ Fusion Protein
- 3HA (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Asc1 (not destroyed)
- 3′ cloning site Pac1 (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1-3XHA-Zmat3R99Q was a gift from Laura Attardi (Addgene plasmid # 167344 ; http://n2t.net/addgene:167344 ; RRID:Addgene_167344) -
For your References section:
Zmat3 Is a Key Splicing Regulator in the p53 Tumor Suppression Program. Bieging-Rolett KT, Kaiser AM, Morgens DW, Boutelle AM, Seoane JA, Van Nostrand EL, Zhu C, Houlihan SL, Mello SS, Yee BA, McClendon J, Pierce SE, Winters IP, Wang M, Connolly AJ, Lowe SW, Curtis C, Yeo GW, Winslow MM, Bassik MC, Attardi LD. Mol Cell. 2020 Nov 5;80(3):452-469.e9. doi: 10.1016/j.molcel.2020.10.022. 10.1016/j.molcel.2020.10.022 PubMed 33157015