pMSR:MSMEG_5431:Dendra
(Plasmid
#167422)
-
PurposeC-term fluorescent fusion
-
Depositing Labs
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 167422 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepMSR:Dendra
-
Vector typeBacterial Expression ; Integrating Mycobacterial Expression Vector attL5. T7 expression in E. coli
Growth in Bacteria
-
Bacterial Resistance(s)Apramycin, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMSMEG_5431
-
SpeciesM. smegmatis
- Promoter pmycTetO
-
Tag
/ Fusion Protein
- Gly-Ala Linker/Dendra2/1x Flag Tag (C terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TGATAGAGTTTGTCCTCCCTATCAG
- 3′ sequencing primer TCCATATGCACCTTGACACG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byCP000480.1
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
5' cloning site: AseI (destroyed), 3' cloning site: HindIII (not destroyed)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMSR:MSMEG_5431:Dendra was a gift from Keith Derbyshire & Joseph Wade (Addgene plasmid # 167422 ; http://n2t.net/addgene:167422 ; RRID:Addgene_167422) -
For your References section:
A Mycobacterial Systems Resource for the Research Community. Judd JA, Canestrari J, Clark R, Joseph A, Lapierre P, Lasek-Nesselquist E, Mir M, Palumbo M, Smith C, Stone M, Upadhyay A, Wirth SE, Dedrick RM, Meier CG, Russell DA, Dills A, Dove E, Kester J, Wolf ID, Zhu J, Rubin ER, Fortune S, Hatfull GF, Gray TA, Wade JT, Derbyshire KM. mBio. 2021 Mar 2;12(2). pii: mBio.02401-20. doi: 10.1128/mBio.02401-20. 10.1128/mBio.02401-20 PubMed 33653882