His-TEV-PRC1
(Plasmid #167539)

• Purpose: For expression of His6-TEV-PRC1 in bacteria.
• Depositing Lab: Tarun Kapoor
• Publication: Subramanian et al Cell. 2013 Jul 18;154(2):377-90. doi: 10.1016/j.cell.2013.06.021.

Backbone

• Vector backbone: pETDuet-1
• Backbone manufacturer: EMD Biosciences
• Backbone size w/o insert (bp): 5420
• Total vector size (bp): 7099
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: IPTG inducible.
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: PRC1
• Species: H. sapiens (human)
• Insert Size (bp): 1863
• GenBank ID: NP_003972
• Entrez Gene: PRC1 (a.k.a. ASE1, MAP65)
• Promoter: T7
• Tag / Fusion Protein:
  • His6 tag (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoR1 (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: GCTAGTTATTGCTCAGCGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry