pMeCP2G pc1121
(Plasmid
#167566)
-
PurposeThe complete rat MeCp2 ORF is fused in frame of the NH2-terminus of the enhanced GFP (isolated from pEGFP-N1 vector; CLONTECH Laboratories, Inc.)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 167566 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEYFP-N1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4700
- Total vector size (bp) 6425
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameMethyl-CpG binding protein 2
-
SpeciesR. norvegicus (rat)
-
Entrez GeneMecp2 (a.k.a. MECP2_e1)
-
Tag
/ Fusion Protein
- GFP
Gene/Insert 2
-
Gene/Insert nameGFP
-
SpeciesAequoria victoria
- Promoter CMV
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (unknown if destroyed)
- 3′ cloning site XbaI (unknown if destroyed)
- 5′ sequencing primer 5'd[CGTCGCCGTCCAGCTCGACCAG]3'
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMeCP2G pc1121 was a gift from Cristina Cardoso (Addgene plasmid # 167566 ; http://n2t.net/addgene:167566 ; RRID:Addgene_167566) -
For your References section:
Methyl CpG-binding proteins induce large-scale chromatin reorganization during terminal differentiation. Brero A, Easwaran HP, Nowak D, Grunewald I, Cremer T, Leonhardt H, Cardoso MC. J Cell Biol. 2005 Jun 6;169(5):733-43. doi: 10.1083/jcb.200502062. 10.1083/jcb.200502062 PubMed 15939760