pENmRFPCNAL2 pc1054
(Plasmid
#167567)
-
PurposeThe fusion protein contains a SV40 NLS followed by mRFP, linker and human PCNA.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 167567 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEVRF
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameProliferating Cell Nuclear Antigen
-
Alt namePCNA
-
SpeciesH. sapiens (human)
-
Entrez GenePCNA (a.k.a. ATLD2)
- Promoter CMV
-
Tag
/ Fusion Protein
- mRFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site BsrGI (not destroyed)
- 5′ sequencing primer AGCTGGACATCACCTCCCACAACG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pENmRFPCNAL2 pc1054 was a gift from Cristina Cardoso (Addgene plasmid # 167567 ; http://n2t.net/addgene:167567 ; RRID:Addgene_167567) -
For your References section:
PCNA acts as a stationary loading platform for transiently interacting Okazaki fragment maturation proteins. Sporbert A, Domaing P, Leonhardt H, Cardoso MC. Nucleic Acids Res. 2005 Jun 21;33(11):3521-8. doi: 10.1093/nar/gki665. Print 2005. 10.1093/nar/gki665 PubMed 15972794